bglii sali site (TaKaRa)
TaKaRa is a verified supplier 
TaKaRa manufactures this product 
97
Structured Review
TaKaRa
bglii sali site
Bglii Sali Site, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 3916 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bglii+site/Bgl+II/pm41928225-78-6-12
Average 97 stars, based on 3916 article reviews
Bglii Sali Site, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 3916 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bglii+site/Bgl+II/pm41928225-78-6-12
Average 97 stars, based on 3916 article reviews
bglii sali site - by Bioz Stars,
2026-09
97/100 stars
Images
Related Articles
Expressing:Article Title: Development of a novel system for the expression and production of recombinant monoclonal antibody, tocilizumab, using Pichia pastoris. Article Snippet: The development of anti-interleukin-6-receptor (IL6R) recombinant monoclonal antibody Tocilizumab (TCZ) production in a methylotrophic yeast Pichia pastoris was the focus of this research work.. The molecular weight of full-length TCZ is approximately 148 kDa.. A bicistronic expression vector with both heavy and light chain genes was constructed within individual inducible alcohol oxidase promoters and secretory signal peptides. Sequencing:Article Title: Development of a novel system for the expression and production of recombinant monoclonal antibody, tocilizumab, using Pichia pastoris. Article Snippet: The development of anti-interleukin-6-receptor (IL6R) recombinant monoclonal antibody Tocilizumab (TCZ) production in a methylotrophic yeast Pichia pastoris was the focus of this research work.. The molecular weight of full-length TCZ is approximately 148 kDa.. A bicistronic expression vector with both heavy and light chain genes was constructed within individual inducible alcohol oxidase promoters and secretory signal peptides. Article Title: Labyrinthulid microorganism capable of producing microbial oil, microbial oil, methods for producing said microorganism and for producing said microbial oil, and uses of said microorganism and said microbial oil Article Snippet: .. A primer set that was set up in the reverse direction so as to insert a Article Title: Wdr59 promotes or inhibits TORC1 activity depending on cellular context Article Snippet: .. Mio3HF-F: TTCTAGGGTTAATACGTACTGTCCGGAGCACCCAC mio3HF-R: CCGGGATCCGATTACGTAATGGAAACCAGAAGCTGAAGC 3xGFP11-5xT7-Nprl2 gRNA construct: CRISPR targeting site: TCGCAGCCGTCTCATTCGTATGG Sense oligo: CTTCGTCGCAGCCGTCTCATTCGTA Antisense oligo: AAACTACGAATGAGACGGCTGCGAC Nprl2 5’ Homologous (HR) fragment cloning: Synthesized 1345 bps fragment containing 5’ Nprl2 homologues sequence and 3XGFP11-5xT7 were cloned into the EcoRV and Article Title: Method for producing microbial oil from labyrinthulid microorganism capable of producing said microbial oil Article Snippet: After amplification with E. coli, the sequence was confirmed using a Dye Terminator Cycle Sequencing Kit (available from Beckman Coulter Inc.) (FIG. 58). .. A primer set that was set up in the reverse direction with the objective of deleting a portion of the C20 elongase gene sequence and inserting a Article Title: Method for producing microbial oil from labyrinthulid microorganism capable of producing said microbial oil Article Snippet: .. A primer set that was set up in the reverse direction so as to insert a Amplification:Article Title: Development of a novel system for the expression and production of recombinant monoclonal antibody, tocilizumab, using Pichia pastoris. Article Snippet: The development of anti-interleukin-6-receptor (IL6R) recombinant monoclonal antibody Tocilizumab (TCZ) production in a methylotrophic yeast Pichia pastoris was the focus of this research work.. The molecular weight of full-length TCZ is approximately 148 kDa.. A bicistronic expression vector with both heavy and light chain genes was constructed within individual inducible alcohol oxidase promoters and secretory signal peptides. Article Title: Labyrinthulid microorganism capable of producing microbial oil, microbial oil, methods for producing said microorganism and for producing said microbial oil, and uses of said microorganism and said microbial oil Article Snippet: .. A primer set that was set up in the reverse direction so as to insert a Article Title: Method for producing microbial oil from labyrinthulid microorganism capable of producing said microbial oil Article Snippet: After amplification with E. coli, the sequence was confirmed using a Dye Terminator Cycle Sequencing Kit (available from Beckman Coulter Inc.) (FIG. 58). .. A primer set that was set up in the reverse direction with the objective of deleting a portion of the C20 elongase gene sequence and inserting a Article Title: Method for producing microbial oil from labyrinthulid microorganism capable of producing said microbial oil Article Snippet: .. A primer set that was set up in the reverse direction so as to insert a Cloning:Article Title: Development of a novel system for the expression and production of recombinant monoclonal antibody, tocilizumab, using Pichia pastoris. Article Snippet: The development of anti-interleukin-6-receptor (IL6R) recombinant monoclonal antibody Tocilizumab (TCZ) production in a methylotrophic yeast Pichia pastoris was the focus of this research work.. The molecular weight of full-length TCZ is approximately 148 kDa.. A bicistronic expression vector with both heavy and light chain genes was constructed within individual inducible alcohol oxidase promoters and secretory signal peptides. Article Title: Wdr59 promotes or inhibits TORC1 activity depending on cellular context Article Snippet: .. Mio3HF-F: TTCTAGGGTTAATACGTACTGTCCGGAGCACCCAC mio3HF-R: CCGGGATCCGATTACGTAATGGAAACCAGAAGCTGAAGC 3xGFP11-5xT7-Nprl2 gRNA construct: CRISPR targeting site: TCGCAGCCGTCTCATTCGTATGG Sense oligo: CTTCGTCGCAGCCGTCTCATTCGTA Antisense oligo: AAACTACGAATGAGACGGCTGCGAC Nprl2 5’ Homologous (HR) fragment cloning: Synthesized 1345 bps fragment containing 5’ Nprl2 homologues sequence and 3XGFP11-5xT7 were cloned into the EcoRV and Clone Assay:Article Title: A humanized monoclonal antibody targeting an ectonucleotidase rescues cardiac metabolism and heart function after myocardial infarction Article Snippet: .. ENPP1 (BstYI fragment from pIRES2-EGFP-ENPP1) was cloned into Article Title: A humanized monoclonal antibody targeting an ectonucleotidase rescues cardiac metabolism and heart function after myocardial infarction. Article Snippet: ENPP1 (BstYI fragment from pIRES2-EGFP-ENPP1) was cloned into BglII site of pAcGFP-C1 (Clontech), while pIRES2-EGFP-ENPP5 was modified by PCR and subsequent bacterial in vivo assembly to remove ENPP5 stop codon and IRES2. .. ENPP1 (BstYI fragment from pIRES2-EGFP-ENPP1) was cloned into Article Title: Wdr59 promotes or inhibits TORC1 activity depending on cellular context Article Snippet: .. Mio3HF-F: TTCTAGGGTTAATACGTACTGTCCGGAGCACCCAC mio3HF-R: CCGGGATCCGATTACGTAATGGAAACCAGAAGCTGAAGC 3xGFP11-5xT7-Nprl2 gRNA construct: CRISPR targeting site: TCGCAGCCGTCTCATTCGTATGG Sense oligo: CTTCGTCGCAGCCGTCTCATTCGTA Antisense oligo: AAACTACGAATGAGACGGCTGCGAC Nprl2 5’ Homologous (HR) fragment cloning: Synthesized 1345 bps fragment containing 5’ Nprl2 homologues sequence and 3XGFP11-5xT7 were cloned into the EcoRV and Modification:Article Title: A humanized monoclonal antibody targeting an ectonucleotidase rescues cardiac metabolism and heart function after myocardial infarction Article Snippet: .. ENPP1 (BstYI fragment from pIRES2-EGFP-ENPP1) was cloned into Article Title: A humanized monoclonal antibody targeting an ectonucleotidase rescues cardiac metabolism and heart function after myocardial infarction. Article Snippet: ENPP1 (BstYI fragment from pIRES2-EGFP-ENPP1) was cloned into BglII site of pAcGFP-C1 (Clontech), while pIRES2-EGFP-ENPP5 was modified by PCR and subsequent bacterial in vivo assembly to remove ENPP5 stop codon and IRES2. .. ENPP1 (BstYI fragment from pIRES2-EGFP-ENPP1) was cloned into Polymerase Chain Reaction:Article Title: A humanized monoclonal antibody targeting an ectonucleotidase rescues cardiac metabolism and heart function after myocardial infarction Article Snippet: .. ENPP1 (BstYI fragment from pIRES2-EGFP-ENPP1) was cloned into Article Title: A humanized monoclonal antibody targeting an ectonucleotidase rescues cardiac metabolism and heart function after myocardial infarction. Article Snippet: ENPP1 (BstYI fragment from pIRES2-EGFP-ENPP1) was cloned into BglII site of pAcGFP-C1 (Clontech), while pIRES2-EGFP-ENPP5 was modified by PCR and subsequent bacterial in vivo assembly to remove ENPP5 stop codon and IRES2. .. ENPP1 (BstYI fragment from pIRES2-EGFP-ENPP1) was cloned into In Vivo:Article Title: A humanized monoclonal antibody targeting an ectonucleotidase rescues cardiac metabolism and heart function after myocardial infarction Article Snippet: .. ENPP1 (BstYI fragment from pIRES2-EGFP-ENPP1) was cloned into Article Title: A humanized monoclonal antibody targeting an ectonucleotidase rescues cardiac metabolism and heart function after myocardial infarction. Article Snippet: ENPP1 (BstYI fragment from pIRES2-EGFP-ENPP1) was cloned into BglII site of pAcGFP-C1 (Clontech), while pIRES2-EGFP-ENPP5 was modified by PCR and subsequent bacterial in vivo assembly to remove ENPP5 stop codon and IRES2. .. ENPP1 (BstYI fragment from pIRES2-EGFP-ENPP1) was cloned into Produced:Article Title: Labyrinthulid microorganism capable of producing microbial oil, microbial oil, methods for producing said microorganism and for producing said microbial oil, and uses of said microorganism and said microbial oil Article Snippet: .. A primer set that was set up in the reverse direction so as to insert a Article Title: Method for producing microbial oil from labyrinthulid microorganism capable of producing said microbial oil Article Snippet: .. A primer set that was set up in the reverse direction so as to insert a Construct:Article Title: Wdr59 promotes or inhibits TORC1 activity depending on cellular context Article Snippet: .. Mio3HF-F: TTCTAGGGTTAATACGTACTGTCCGGAGCACCCAC mio3HF-R: CCGGGATCCGATTACGTAATGGAAACCAGAAGCTGAAGC 3xGFP11-5xT7-Nprl2 gRNA construct: CRISPR targeting site: TCGCAGCCGTCTCATTCGTATGG Sense oligo: CTTCGTCGCAGCCGTCTCATTCGTA Antisense oligo: AAACTACGAATGAGACGGCTGCGAC Nprl2 5’ Homologous (HR) fragment cloning: Synthesized 1345 bps fragment containing 5’ Nprl2 homologues sequence and 3XGFP11-5xT7 were cloned into the EcoRV and CRISPR:Article Title: Wdr59 promotes or inhibits TORC1 activity depending on cellular context Article Snippet: .. Mio3HF-F: TTCTAGGGTTAATACGTACTGTCCGGAGCACCCAC mio3HF-R: CCGGGATCCGATTACGTAATGGAAACCAGAAGCTGAAGC 3xGFP11-5xT7-Nprl2 gRNA construct: CRISPR targeting site: TCGCAGCCGTCTCATTCGTATGG Sense oligo: CTTCGTCGCAGCCGTCTCATTCGTA Antisense oligo: AAACTACGAATGAGACGGCTGCGAC Nprl2 5’ Homologous (HR) fragment cloning: Synthesized 1345 bps fragment containing 5’ Nprl2 homologues sequence and 3XGFP11-5xT7 were cloned into the EcoRV and Synthesized:Article Title: Wdr59 promotes or inhibits TORC1 activity depending on cellular context Article Snippet: .. Mio3HF-F: TTCTAGGGTTAATACGTACTGTCCGGAGCACCCAC mio3HF-R: CCGGGATCCGATTACGTAATGGAAACCAGAAGCTGAAGC 3xGFP11-5xT7-Nprl2 gRNA construct: CRISPR targeting site: TCGCAGCCGTCTCATTCGTATGG Sense oligo: CTTCGTCGCAGCCGTCTCATTCGTA Antisense oligo: AAACTACGAATGAGACGGCTGCGAC Nprl2 5’ Homologous (HR) fragment cloning: Synthesized 1345 bps fragment containing 5’ Nprl2 homologues sequence and 3XGFP11-5xT7 were cloned into the EcoRV and Plasmid Preparation:Article Title: Method for producing microbial oil from labyrinthulid microorganism capable of producing said microbial oil Article Snippet: After amplification with E. coli, the sequence was confirmed using a Dye Terminator Cycle Sequencing Kit (available from Beckman Coulter Inc.) (FIG. 58). .. A primer set that was set up in the reverse direction with the objective of deleting a portion of the C20 elongase gene sequence and inserting a |